Hi,
I am trying to run a bedtools slop on my.bed file and hg19.genome
bedtools slop -i H3K27me3.bed -g hg19.genome -b 30
I get the following error:
Less than the req'd two fields were encountered in the genome file (genomes/hg19.genome) at line 2. Exiting.
Any suggestions?
Thanks in advance
Samad
How can you call Bedtools intersect on a tab and bed file? without getting the typical:
"Differing number of BED fields encountered at line: #. Exiting..."
Error.
My bed file has 15 columns and my tab file has 18
I am using bowtie2 to map my PE reads.
I have indexed multiple bacterial genomes by putting them together in a multi-fasta file fashion.
bowtie2 -q -a -p 1 -x Multi -1 R100_1.fq -2 R100_2.fq -U 100_Orph.fastq -S 100.sam
samtools view -b -S 100.sam -o 100.bam
coverageBed -abam 100.bam -b BED_RefSeq >>100.cvg
CoverageBed ouput for genome("307679329")is : 307679329 1 25751 72 3568 25750 0.1385631but when I index genome ("307679329") separately then CoverageBed output is:
307679329 1 25751 449 8369 25750 0.3250097Can someone explain this differnece
I have around 20k samples with BED files. How can I calculate reciprocal overlap for each segment? I want to find all segments with 50% reciprocal overlap or better.
Is there an easy way of finding, probably with bedtools, given a window size, the top N most correlated regions when comparing two bed/wig files? For example, in comparing two bed/wig/bam files that have PolII data for 2 conditions, to give the top N windows where the wiggle profiles are most similar?
I am trying to do an overlap analysis between 200 danish exomes (VCF courtsey: Zev) and 10 different gene regions.
I would like to know what percentage overlaps between my region of interest (in mygenes.bed total of 36
lines representing the region) and a VCF file (Danish_*.flt.vcf.gz).
I have tried this command and got result: intersectBed -a Danish1.flt.vcf.gz -b mygenes.bed > D1result.txt
Danish1.flt.vcf.gz: here mygenes.bed: here D1overlapped.txt: here
My assumption is that the output should have lines <= the total number of lines in the mygenes.bed file. But in many instances I am getting more than 36 lines as output. May be am missing something important or may be another tool / option in bedtools can do this task more efficiently. Please let me know your thoughts.
I do have a set of TF binding coordinates and want to see if there is any significant overlap with an open chromatin annotation.
Example of TF coord:
chr1 19280 19298
chr1 245920 245938
chr2 97290 97308
chr9 752910 752938
...
Example of open chrom. coord. (UCSC track):
chr2 33031543 33032779
chr3 2304169 2304825
chr5 330899 330940
...
I have checked the intersection with the Bedtools (open chrom. coord vs TF coord. -/+ 100bp) and now I want to check the intersection between random genomic coordinates and open chrom.
The idea is to:
Any ideas how can I do this simulation to pick random genomic positions from the same chromosome? I know a little bit of bash and Perl, but won't be able to write the script by myself.
Is it possible to measure the length of every chromosome;
Pick TF chromosome and from it's length get a random number which would represent a genomic position?
Can someone help me with the simulation and the pipeline.
I am trying to use bedtools to pull out the reads falling directly within a set of BED coordinates. While this command does it successfully:
intersectBed -abam mybam.bam -b intervals.gff -wa -wb -f 1 | coverageBed -abam stdin -b intervals.gffI find that it loses key information that I need. I'd like to get a listing of the BAM reads -- getting at least their ID -- split by exon. In other words, all the read IDs that fall into the first interval in intervals.gff, all the read IDs that fall into the second interval in intervals.gff... ideally, it would also report the CIGAR string for these reads, but I'd settle for just the ID.
Is there a way to report these reads, such that it's easy to tell from the output which set of reads landed in a given interval in the input BED file?
Thanks you.
.bam file and .bigwig file. Thus, it occurs to me that I want to give a try to reproduce the data visualization with tool: BEDtools and other related tools.
Result
I'll first upload the difference between my-version and official version:
Top to Bottom:
Hi,
I have question about bigwigsummary tools ,
I have my start and end positions and my bigwig file but I want to check whole genome instead of chromosome by chromosome Is there any option to use this tool in that way ?
I know that for each chromosome I have to use :
bigWigSummary -type=X bigwigfile chrN start end datapointsI want to check from chr1 to chrX.
Thanks in Advance.
>chr01
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
a BED file with my genomic coordinates (already sorted)
chr01 187814 190840
chr01 307073 310104
chr01 701047 704068
chr01 702941 705962
chr01 702952 705972
chr01 867716 870740
chr01 914064 917087
chr01 991080 994104
chr01 1039795 1042815
chr01 1058713 1061736
And then I write the command line:
bedtools getfasta -fi all.con -bed 1-13sorted2.bed -fo NewCandidates/Genomiccoordinates/1-13_1500.fa
The only thing that I get is "WARNING. chromosome (chr01) was not found in the FASTA file. Skipping." , thousands of tim ...
I extracted sequences with fastaFromBed and have no complains about the BEDTools which is really awesome thing.
Otherwise extracted sequences look like this:
>chr19:13985513-13985622
GGAAAATTTGCCAAGGGTTTGGGGGAACATTCAACCTGTCGGTGAGTTTGGGCAGCTCAGGCAAACCATCGACCGTTGAGTGGACCCTGAGGCCTGGAATTGCCATCCT>chr19:13985689-13985825
TCCCCTCCCCTAGGCCACAGCCGAGGTCACAATCAACATTCATTGTTGTCGGTGGGTTGTGAGGACTGAGGCCAGACCCACCGGGGGATGAATGTCACTGTGGCTGGGCCAGACACGAnd my input file looks like this:
>chr19
agtcccagctactcgggaggctaaggcaggagaatcgcttgaacccagga
ggtggaggttgcagggagccgagatcgcaccactgcactccagcctgggc
gacagagcgagattccgtctcaaaaagtaaaataaaataaaataaaaaat
aaaagtttgatatattcagaatcagggaggtctgctgggtgcagttcatt
tgaaaaattcctcagcattttagtGATCTGTATGGTCCCTCtatctgtca
gggtcctagcaggaaattgttgcactctcaaaggattaagcagaaagagtI was using this:
fastaFromBed -fi input -bed seq.bed -fo outputSo shouldn't those sequences be formed in FASTA format (as ncbi says "It is recommended that all lines of text be shorter than 80 characters in length") or at least the same line length as my input file?
What I am doing wrong that I am getting linearized (fasta?) output with fastaFromBed?
What is the quickest way to turn those linear sequences to nicely formatted columns using command line?
I've been dealing with comparison between two bed files using intersectBed -a -b command.
I'm just wondering, is there any commands in Bedtools which can help us compare multiple bed files?
Say, I have 3 bed files (A,B,C). I want to identify those regions where any two of the three (AB,BC,AC)overlaps reciprocally 50%.....
thx
edit:
Just find this post right now.Maybe I didn't express quite well a couple of months ago.
I mean to find those overlappings which spans at least 50% of EACH of the multiple bed files.
So I don't quite understand cat AB BC AC > ABC.common
Means to find the overlapping part of all the three?
I myself try to solve the problem like below:
intersectBed -a 2 -b 3 > 23
intersectBed -a 1 -b 3 > 13
intersectBed -a 1 -b 2 > 12
intersectBed -a 1 -b 23 -f 0.50|sort > 23_1
intersectBed -a 2 -b 13 -f 0.50|sort > 13_2
intersectBed -a 3 -b 12 -f 0.50|sort > 12_3
comm -1 -2 23_1 13_2 > test
comm -1 -2 test 1_3 > final resultI don't know if I'm on the right track. thx
given a FASTQ file and a BAM file of aligned reads, is there an efficient way to get all FASTQ reads that are in the original FASTQ but not in the BAM? Perhaps using bedtools. i.e.:
unmapped_script original.fastq aligned.bam > unmapped.fastqshould create an unmapped.fastq file, which is a subset of original.fastq containing only those entries that do not appear in aligned.bam
thank you.
Experiment: deep sequencing for mutants in 700nt fragment.
the fragment of dna was preamplified by primers flanking the fragment followed by hiseq.
per base coverage was calculated by coverageBed -d -abam in.bam -b ref.bed > out.cov
Observation: two distinct peaks in coverage at the ends as below plot.. coverage vs positions
the peaks are made from reads having part of primers..thus also show soft clipping at ends..
there is a huge difference in the calculations if i include such reads And if I exclude them.
Question: is there anyone who knows how to handle such a situation?
I would like to know if there is a memory-efficent way of sorting and merging a large amount of bed files, each of them containing millions of entries, into a single bed file that merges the entries, either duplicated or partially overlapping, so that they are unique in the file.
I have tried the following but it blows up in memory beyond the 32G I have available here:
find /my/path -name '*.bed.gz' | xargs gunzip -c | ~/src/bedtools-2.17.0/bin/bedtools sort | ~/src/bedtools-2.17.0/bin/bedtools merge | gzip -c > bed.all.gzAny suggestions?
chr7 127471196 127472363 Pos1 12 + 127471196 127472363 255,0,0
chr7 127472363 127473530 Pos2 200 + 127472363 127473530 255,0,0
chr7 127473530 127474697 Pos3 120 + 127473530 127474697 255,0,0
chr7 127474697 127475864 Pos4 54 + 127474697 127475864 255,0,0
chr7 127475864 127477031 Neg1 2 - 127475864 127477031 0,0,255
chr7 127477031 127478198 Neg2 15 - 127477031 127478198 0,0,255
chr7 127478198 127479365 Neg3 25 - 127478198 127479365 0,0,255
chr7 127479365 127480532 Pos5 2 + 127479365 127480532 255,0,0
chr7 127480532 127481699 Neg4 9 - 127480532 127481699 0,0,255
According to the BED format's specs, the fifth column contains a score, between 0 and 1000 (alternatively, in the bedGraph format the score is on the 4th position). If I want to get all the regions that have a score higher than 20, for example, I can do an awk search:
$: awk '$5 > 20 {print}' mybedfile.bed
However, in order to use awk, I have to keep the BED file in a uncompressed format. It would be much better if I could use the .starch format in Bedops, or if I could combine any Bedops/Bedtools operation with th ...